Top » Catalog » SNPs » A11528

$18.00

A11528
[A11528]

A11528
HG19 Position: ChrY:16436374..16436374
Ancestral: G
Derived: A
Reference: George Jamieson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11528_F AAAGGAAGTGACATTGAGGAGG
Reverse Primer: A11528_R TTTTGGGTTCTTGTGACTTCAG
Reviews

Customers who bought this product also purchased
A11529
A11529
A11527
A11527
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies