Top » Catalog » SNPs » A11529

$18.00

A11529
[A11529]

A11529
HG19 Position: ChrY:12785366..12785366
Ancestral: G
Derived: T
Reference: George Jamieson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11529_F GCTCCCCTACCCTCAAAGTC
Reverse Primer: A11529_R CAGCCACTTTGGAAAAACTTG
Reviews

Customers who bought this product also purchased
A11528
A11528
A11527
A11527
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11111
1 x A117
$36.00
Haplogroup Info
Other products
Currencies