Top » Catalog » SNPs » A11535

$18.00

A11535
[A11535]

A11535
HG19 Position: ChrY:15163576..15163576
Ancestral: G
Derived: A
Reference: Wayne Kauffman (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC564
Forward Primer: A11535v2_F CAAAATGATGATTGTCAGGGAC
Reverse Primer: A11535v2_R GATATTCAGTGTGCAATTCATTGG
Reviews

Customers who bought this product also purchased
DYS520
DYS520
DYS441
DYS441
DYS534
DYS534
DYS463
DYS463
DYS650
DYS650
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies