Top » Catalog » SNPs » A11536

$18.00

A11536
[A11536]

A11536
hg38 Position: ChrY:13362983..13362983
Ancestral: T
Derived: C
Reference: Wayne Kauffman (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC564
Forward Primer: A11536v2_F AGCAGGTTAATTACCTTCATCTGAG
Reverse Primer: A11536v2_R GGCCAATATGGTGAAACACTG
Reviews

Customers who bought this product also purchased
DYS520
DYS520
DYS441
DYS441
DYS534
DYS534
DYS463
DYS463
DYS650
DYS650
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies