Top » Catalog » SNPs » A11536

$17.50

A11536
[A11536]

A11536
HG19 Position: ChrY:15474863..15474863
Ancestral: T
Derived: C
Reference: Wayne Kauffman (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC564
Forward Primer: A11536v2_F AGCAGGTTAATTACCTTCATCTGAG
Reverse Primer: A11536v2_R GGCCAATATGGTGAAACACTG
Reviews

Customers who bought this product also purchased
DYS532
DYS532
DYS520
DYS520
DYS441
DYS441
DYS534
DYS534
DYS463
DYS463
DYS650
DYS650
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies