Top » Catalog » SNPs » A11536

$18.00

A11536
[A11536]

A11536
HG19 Position: ChrY:13362983..13362983
Ancestral: T
Derived: C
Reference: Wayne Kauffman (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC564
Forward Primer: A11536v2_F AGCAGGTTAATTACCTTCATCTGAG
Reverse Primer: A11536v2_R GGCCAATATGGTGAAACACTG
Reviews

Customers who bought this product also purchased
DYS712
DYS712
DYS717
DYS717
DYS504
DYS504
DYS444
DYS444
DYS532
DYS532
DYS520
DYS520
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10888
1 x A11181
1 x A10852
$54.00
Haplogroup Info
Other products
Currencies