Top » Catalog » SNPs » A11537

$18.00

A11537
[A11537]

A11537
HG19 Position: ChrY:15534947..15534947
Ancestral: G
Derived: A
Reference: Alexey Berezhnoy (2016)
ISOGG Haplogroup: I1a (not listed)
Comments: Below Z63 > L1237 > FGC9550
Forward Primer: A11537v2_F GATCCCTTGTAATCCCAGCC
Reverse Primer: A11537v2_R TGAGGAAATCCGCAAGTACTATG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10646
1 x A10511
1 x A10260
$54.00
Haplogroup Info
Other products
Currencies