Top » Catalog » SNPs » A11538

$18.00

A11538
[A11538]

A11538
HG19 Position: ChrY:3717199..3717199
Ancestral: ins
Derived: del
Reference: Alan Kane (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of BY4142
Forward Primer: A11538_F TGCCATCTGCAAACAGACAG
Reverse Primer: A11538_R GCCCAGGAATTCAAGAGTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies