Top » Catalog » SNPs » A11539

$18.00

A11539
[A11539]

A11539
hg38 Position: ChrY:6787964..6787964
Ancestral: C
Derived: T
Reference: Alan Kane (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of BY4142
Forward Primer: A11539_F TCCACGTAAGCCGGATAGAC
Reverse Primer: A11539_R GGTGACACCCCCTGTATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies