Top » Catalog » SNPs » A11540

$18.00

A11540
[A11540]

A11540
hg38 Position: ChrY:7835264..7835264
Ancestral: G
Derived: T
Reference: Alan Kane (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of BY4142
Forward Primer: A11540_F GCAACTGGAGCTATTCAAGAGTAC
Reverse Primer: A11540_R GCAGTAGCCAAGAATTCTACAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies