Top » Catalog » SNPs » A11540

$18.00

A11540
[A11540]

A11540
HG19 Position: ChrY:7835264..7835264
Ancestral: G
Derived: T
Reference: Alan Kane (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of BY4142
Forward Primer: A11540_F GCAACTGGAGCTATTCAAGAGTAC
Reverse Primer: A11540_R GCAGTAGCCAAGAATTCTACAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10221
1 x A11125
1 x A10198
1 x A10660
1 x A11474
1 x A1058
1 x A10424
1 x A10567
1 x A11115
1 x A11385
$180.00
Haplogroup Info
Other products
Currencies