Top » Catalog » SNPs » A11541

$17.50

A11541
[A11541]

A11541
HG19 Position: ChrY:8861860..8861860
Ancestral: C
Derived: T
Reference: Alan Kane (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of BY4142
Forward Primer: A11541_F CAGGCGAGCCTTGTTTTTAC
Reverse Primer: A11541_R AGAATCGGGTCCTATGGAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies