Top » Catalog » SNPs » A11545

$18.00

A11545
[A11545]

A11545
HG19 Position: ChrY:16658104..16658104
Ancestral: ins
Derived: del
Reference: Alan Kane (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of BY4142
Forward Primer: A11545_F AGGGTGAGAACCCAAACCTC
Reverse Primer: A11545_R GCATAAGAATTGTATCACATTCGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10680
1 x A11682
1 x A10982
1 x A10987
1 x A10943
1 x A11195
1 x A11502
$126.00
Haplogroup Info
Other products
Currencies