Top » Catalog » SNPs » A11530

$18.00

A11530
[A11530]

A11530
HG19 Position: ChrY:15351962..15351962
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11530_F CAGAATTGCTCAAGGGAGTTC
Reverse Primer: A11530_R TGCCTGTGGCTTAAAGTATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies