Top » Catalog » SNPs » A11531

$18.00

A11531
[A11531]

A11531
HG19 Position: ChrY:19253102..19253102
Ancestral: G
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11531_F CAGGTGAGACTTGAAGAGATTTCAC
Reverse Primer: A11531_R CCACCTTTCAATGTCTTCTTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies