Top » Catalog » SNPs » A11533

$18.00

A11533
[A11533]

A11533
hg38 Position: ChrY:9612866..9612866
Ancestral: A
Derived: G
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11533_F CCATTCCTCATTCCTTAAATCG
Reverse Primer: A11533_R CAGTGTTTGTGTGTGAGATGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10762
1 x A11490
$36.00
Haplogroup Info
Other products
Currencies