Top » Catalog » SNPs » A11549

$18.00

A11549
[A11549]

A11549
HG19 Position: ChrY:8581999..8581999
Ancestral: C
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11549_F GAATTCAGTTCCCAGCCAAG
Reverse Primer: A11549_R GCATTCCACTCCCATTTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11019
1 x A11487
1 x A10329
1 x A10928
$72.00
Haplogroup Info
Other products
Currencies