Top » Catalog » SNPs » A11549

$18.00

A11549
[A11549]

A11549
HG19 Position: ChrY:8581999..8581999
Ancestral: C
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11549_F GAATTCAGTTCCCAGCCAAG
Reverse Primer: A11549_R GCATTCCACTCCCATTTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10424
1 x A1163
1 x A1117
1 x A11081
1 x A1165
1 x A10931
1 x A10089
1 x A10961
$144.00
Haplogroup Info
Other products
Currencies