Top » Catalog » SNPs » A11550

$18.00

A11550
[A11550]

A11550
HG19 Position: ChrY:16746935..16746935
Ancestral: A
Derived: G
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11550_F ATTTGCTGAAAGATTATTGGATGC
Reverse Primer: A11550_R ATGACTGGTTGATGGGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10745
1 x A11345
$36.00
Haplogroup Info
Other products
Currencies