Top » Catalog » SNPs » A11552

$18.00

A11552
[A11552]

A11552
hg38 Position: ChrY:21637881..21637881
Ancestral: G
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11552_F ATTTCATGCTGTCGGCTTTC
Reverse Primer: A11552_R CAAGCTCATGCTGCTCAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies