Top » Catalog » SNPs » FGC10673

$18.00

FGC10673
[FGC10673]

FGC10673
hg38 Position: ChrY:19394044..19394044
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10673_F CGGTAAATACCTATTCTATTTTTCTTAGGTTAG
Reverse Primer: FGC10673_R GAGTATCTCACATTTCAATAATAATGTCAAC
Reviews

Customers who bought this product also purchased
Y2211
Y2211
FGC10669
FGC10669
FGC10656
FGC10656
FGC10671
FGC10671
FGC10663
FGC10663
FGC10668
FGC10668
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies