Top » Catalog » SNPs » FGC10673

$18.00

FGC10673
[FGC10673]

FGC10673
hg38 Position: ChrY:19394044..19394044
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10673_F CGGTAAATACCTATTCTATTTTTCTTAGGTTAG
Reverse Primer: FGC10673_R GAGTATCTCACATTTCAATAATAATGTCAAC
Reviews

Customers who bought this product also purchased
BZ113
BZ113
FGC10654
FGC10654
FGC10675
FGC10675
BZ3025
BZ3025
FGC10666
FGC10666
FGC10670
FGC10670
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies