Top » Catalog » SNPs » BZ3025

$18.00

BZ3025
[BZ3025]

BZ3025
hg38 Position: ChrY:10212905..10212905
Ancestral: G
Derived: A
Reference: Alessandro Biondo (2016)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: BZ3025_F CATCACAAAAGAAGATACTCAGAAAGCT
Reverse Primer: BZ3025_R GAAATATCTTCACATAAAAACTAGACCAATG
Reviews

Customers who bought this product also purchased
FGC10667
FGC10667
FGC10653
FGC10653
BZ113
BZ113
FGC10659
FGC10659
FGC10674
FGC10674
FGC10666
FGC10666
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies