Top » Catalog » SNPs » FGC10657

$18.00

FGC10657
[FGC10657]

FGC10657
hg38 Position: ChrY:8724670..8724670
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10657_F AAAAGCTGTCGGTCAAAACC
Reverse Primer: FGC10657_R ACAGATGGCCACTGAGGTTC
Reviews

Customers who bought this product also purchased
FGC10653
FGC10653
BZ113
BZ113
BZ3025
BZ3025
FGC10674
FGC10674
FGC10666
FGC10666
Q1b-Y2225* Panel
Q1b-Y2225* Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies