Top » Catalog » SNPs » A11611

$17.50

A11611
[A11611]

A11611
HG19 Position: ChrY:18688521..18688521
Ancestral: C
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11611_F TGCCAAATTTTAAGTTTGACTATCAC
Reverse Primer: A11611_R TGTCCTAGGCTCTAAACCTAGTGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies