Top » Catalog » SNPs » P77

$18.00

P77
[P77]

P77
hg38 Position: ChrY:12814267..12814267
Ancestral: G
Derived: A
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: T1a1a1b2b2b1a
Comments: 486 Ya5; below L906/CTS660 > FGC3987
Forward Primer: P77_F CATGTGTGAGTAACTACTTGAGATTACATG
Reverse Primer: P77_R TACATACATATAAATGCATAGACAGAGATAATC
Reviews

Customers who bought this product also purchased
FGC48929
FGC48929
Y21332
Y21332
CTS9882
CTS9882
Y31472
Y31472
HU365
HU365
Y59754
Y59754
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies