Top » Catalog » SNPs » A11619

$17.50

A11619
[A11619]

A11619
HG19 Position: ChrY:14349482..14349482
Ancestral: T
Derived: G
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11619_F AAGCTATAAAATTACACACTGAAAAGAACA
Reverse Primer: A11619_R TGCTTTGCATATAACCCAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies