Top » Catalog » SNPs » A11621

$18.00

A11621
[A11621]

A11621
HG19 Position: ChrY:14518615..14518615
Ancestral: C
Derived: T
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11621_F CTACTCTGAAATTTCCCTATTACTGGG
Reverse Primer: A11621_R GCATACAGAAGGCATAACAAGCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies