Top » Catalog » SNPs » A11623

$18.00

A11623
[A11623]

A11623
HG19 Position: ChrY:15632629..15632629
Ancestral: G
Derived: A
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11623_F CTTGCCCAGGCTGATCTTAG
Reverse Primer: A11623_R ATACAAGTAGGTTACCTAGTAAAAGGGACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1105
1 x A10652
1 x A10312
1 x A10685
$72.00
Haplogroup Info
Other products
Currencies