Top » Catalog » SNPs » A11625

$18.00

A11625
[A11625]

A11625
HG19 Position: ChrY:16555734..16555734
Ancestral: A
Derived: C
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11625_F GCATGAGTATGGGGAAGTGG
Reverse Primer: A11625_R GGTGGTGGGAATCATTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11239
1 x A10327
1 x A10614
1 x A11553
1 x A10586
$90.00
Haplogroup Info
Other products
Currencies