Top » Catalog » SNPs » A11627

$18.00

A11627
[A11627]

A11627
HG19 Position: ChrY:18648254..18648254
Ancestral: T
Derived: C
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11627_F GGGTTCAGCACACCAACG
Reverse Primer: A11627_R TCAAGGAGAAGTGTGAAGATTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11054
$18.00
Haplogroup Info
Other products
Currencies