Top » Catalog » SNPs » A11628

$18.00

A11628
[A11628]

A11628
HG19 Position: ChrY:18890086..18890086
Ancestral: T
Derived: C
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11628_F GGTCACAATGTCAGCCTCAG
Reverse Primer: A11628_R AATCCAGGCTCCATTCTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1148
1 x A10879
1 x A10059
1 x A10641
1 x A10122
1 x A11379
1 x A10112
$126.00
Haplogroup Info
Other products
Currencies