Top » Catalog » SNPs » A11630

$17.50

A11630
[A11630]

A11630
HG19 Position: ChrY:22763184..22763184
Ancestral: C
Derived: G
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11630_F GATGCCTTTCAGCCTGTAGTG
Reverse Primer: A11630_R TTCCCACACCTATCCTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies