Top » Catalog » SNPs » A11631

$18.00

A11631
[A11631]

A11631
HG19 Position: ChrY:20977529..20977529
Ancestral: G
Derived: A
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11631_F ATAAGGTCACCATTCCTAAATCG
Reverse Primer: A11631_R ACTGATTGCTGGGTTTGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10030
1 x A11534
1 x A11114
$54.00
Haplogroup Info
Other products
Currencies