Top » Catalog » SNPs » A11635

$18.00

A11635
[A11635]

A11635
HG19 Position: ChrY:7995613..7995613
Ancestral: G
Derived: T
Reference: Richard Densmore (2016)
ISOGG Haplogroup: R1b
Comments: Downstream DF27 > A6137
Forward Primer: A11635_F CTGAGTGATGTGTAATCCAGCTC
Reverse Primer: A11635_R TACAACTTAGGAATGTGGAACCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10684
1 x A10253
1 x A10293
1 x A10740
$72.00
Haplogroup Info
Other products
Currencies