Top » Catalog » SNPs » A11637

$18.00

A11637
[A11637]

A11637
HG19 Position: ChrY:21172071..21172071
Ancestral: C
Derived: G
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1b
Comments: Downstream Y15926
Forward Primer: A11637_F TTCCCCATCTTCGTGGG
Reverse Primer: A11637_R ACAGACGCTGATGAATGAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11471
1 x A1070
1 x A10026
$54.00
Haplogroup Info
Other products
Currencies