Top » Catalog » SNPs » A11641

$18.00

A11641
[A11641]

A11641
HG19 Position: ChrY:12273079..12273079
Ancestral: G
Derived: C
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1b
Comments: Downstream BY3172
Forward Primer: A11641_F CATGAGCCACCACGCG
Reverse Primer: A11641_R GCTAAAGCTGCAGCAAGCTATTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1049
1 x A11550
1 x A11526
1 x A10053
1 x A11375
$90.00
Haplogroup Info
Other products
Currencies