Top » Catalog » SNPs » A11644

$18.00

A11644
[A11644]

A11644
HG19 Position: ChrY:7837100..7837101
Ancestral: del
Derived: ins
Reference: YFull (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11644_F CACCTGTTTTCTTGGCCTTG
Reverse Primer: A11644_R TTTGCACACCCAGCTGATAG
Reviews

Customers who bought this product also purchased
YFS069229
YFS069229
YFS069220
YFS069220
YFS069197
YFS069197
YFS069212
YFS069212
DYS487
DYS487
YFS069095
YFS069095
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies