Top » Catalog » SNPs » A11646

$18.00

A11646
[A11646]

A11646
HG19 Position: ChrY:15665972..15665972
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A11646v2_F CTCTAAATGCTGCTTTAGCTATGG
Reverse Primer: A11646v2_R TCAGGACTTGAGCTCTGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies