Top » Catalog » SNPs » A11648

$18.00

A11648
[A11648]

A11648
HG19 Position: ChrY:12932120..12932120
Ancestral: T
Derived: A
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11648_F ACCTCACAGCATATGGACATACC
Reverse Primer: A11648_R GAAGGTGGAGGATGTGAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies