Top » Catalog » SNPs » A11650

$18.00

A11650
[A11650]

A11650
hg38 Position: ChrY:13210896..13210896
Ancestral: G
Derived: C
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11650_F CTGCCACTCTGCATCTTTTTATAG
Reverse Primer: A11650_R TGGAGACATCCCACAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies