Top » Catalog » SNPs » A11651

$18.00

A11651
[A11651]

A11651
hg38 Position: ChrY:12858796..12858796
Ancestral: C
Derived: A
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11651_F TTCCAAGTGTTGCTGCTCTG
Reverse Primer: A11651_R TCACCTCCCTAGAGAATGTACCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11111
1 x A11112
$36.00
Haplogroup Info
Other products
Currencies