Top » Catalog » SNPs » A11652

$17.50

A11652
[A11652]

A11652
HG19 Position: ChrY:14831532..14831532
Ancestral: G
Derived: C
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11652_F AACAGCAATAGGAACCTGTAATCC
Reverse Primer: A11652_R AATTTAATGGCAACACATTACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies