Top » Catalog » SNPs » A11653

$18.00

A11653
[A11653]

A11653
HG19 Position: ChrY:9416630..9416630
Ancestral: T
Derived: C
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11653_F CAAATAAGTAGAGAGCCTAGGACAAATG
Reverse Primer: A11653_R AGAGTTGTTGTCAATACTCACTGTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies