Top » Catalog » SNPs » A11659

$18.00

A11659
[A11659]

A11659
hg38 Position: ChrY:21824150..21824150
Ancestral: C
Derived: G
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11659_F GAGGTGAGAATACAATCATACAACCTC
Reverse Primer: A11659_R CGTGACAGTGTTAAGAAGAACACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies