Top » Catalog » SNPs » A11660

$16.00

A11660
[A11660]

A11660
HG19 Position: ChrY:17833160..17833160
Ancestral: T
Derived: A
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11660_F CTCAAAGTTTATTAGAATCCCAGAGG
Reverse Primer: A11660_R TCACTCCCTAAAATGTCCTAAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies