Top » Catalog » SNPs » A11661

$18.00

A11661
[A11661]

A11661
HG19 Position: ChrY:15479075..15479075
Ancestral: G
Derived: A
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11661_F GGAGCTTCTTCCACTGATGG
Reverse Primer: A11661_R CCAGCCTTGAGGTTTCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1074
1 x A10144
1 x A11372
1 x A11686
$72.00
Haplogroup Info
Other products
Currencies