Top » Catalog » SNPs » A11661

$16.00

A11661
[A11661]

A11661
HG19 Position: ChrY:17590955..17590955
Ancestral: G
Derived: A
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11661_F GGAGCTTCTTCCACTGATGG
Reverse Primer: A11661_R CCAGCCTTGAGGTTTCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies