Top » Catalog » SNPs » A11662

$18.00

A11662
[A11662]

A11662
HG19 Position: ChrY:14203968..14203968
Ancestral: G
Derived: T
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11662_F CGTGTTGGCCTAGATGGTC
Reverse Primer: A11662_R TGCAATCCAATGCACTTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11027
$18.00
Haplogroup Info
Other products
Currencies