Top » Catalog » SNPs » A11663

$18.00

A11663
[A11663]

A11663
HG19 Position: ChrY:16565725..16565725
Ancestral: C
Derived: A
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11663_F GGAATTGATAAGCTATAGGAAAATTCTG
Reverse Primer: A11663_R AAGGAATAAATTTGAAGCTTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies