Top » Catalog » SNPs » A11666

$18.00

A11666
[A11666]

A11666
HG19 Position: ChrY:14125513..14125513
Ancestral: A
Derived: G
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11666_F GCTTCATTTTGTAGTGTCAGTGC
Reverse Primer: A11666_R AGTCTCCCAGCTACCATTAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10936
1 x A10509
1 x A11226
$54.00
Haplogroup Info
Other products
Currencies