Top » Catalog » SNPs » A11667

$18.00

A11667
[A11667]

A11667
hg38 Position: ChrY:7335148..7335148
Ancestral: A
Derived: G
Reference: Robert Dunn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS4157
Forward Primer: A11667_F TCCACCCTGCTGTATGTCTG
Reverse Primer: A11667_R CCAAACAGAAACTCCCTCCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies